A Flash-Induced Robust Cu Electrode on Glass Substrates and Its Application for Thin-Film μLEDs

A Flash-Induced Robust Cu Electrode on Glass Substrates and Its Application for Thin-Film μLEDs

May 7, 2021 Application of montmorillonite in bentonite as a pharmaceutical excipient in drug delivery systems. Assay Kits Atomic Force Microscopy to Identify Dehydration Temperatures for Small Volumes of Active Pharmaceutical Ingredients. cDNA Clia Kits Culture Cells Devices DNA DNA Templates DNA Testing Elisa Kits Enzymes Equipments Exosomes Gels Isotypes Medium & Serums My Blog NATtrol Panel Paper-Based Electrochemical Devices for the Pharmaceutical Field: State of the Art and Perspectives. Particles Pcr Kits Peptides Reagents Recombinant Proteins Ria Kits Test Kits Western Blot
A sturdy Cu conductor on a glass substrate for thin-film μLEDs utilizing the flash-induced chemical/bodily interlocking between Cu and glass is reported. During millisecond gentle irradiation, CuO nanoparticles (NPs) on the show substrate are reworked right into a conductive Cu movie by discount and sintering. At the identical time, intensive heating on the boundary of CuO NPs and glass chemically induces the formation of an ultrathin Cu2 O interlayer throughout the Cu/glass interface for robust adhesion. Cu nanointerlocking happens by transient glass softening and interface fluctuation to extend the contact space.
Owing to those flash-induced interfacial interactions, the flash-activated Cu electrode reveals an adhesion power of 10 J m-2 , which is 5 occasions larger than that of vacuum-deposited Cu. An AlGaInP thin-film vertical μLED (VLED) types {an electrical} interconnection with the flash-induced Cu electrode by way of an ACF bonding course of, leading to a excessive optical energy density of 41 mW mm-2 . The Cu conductor allows dependable VLED operation no matter harsh thermal stress and moisture infiltration below a high-temperature storage check, temperature humidity check, and thermal shock check. 50 × 50 VLED arrays transferred onto the flash-induced sturdy Cu electrode present excessive illumination yield and uniform distribution of ahead voltage, peak wavelength, and system temperature.
Remote educating within the tertiary training sector is a comparatively frequent apply, and the implementation of digital options in chemistry educating presents many new alternatives and instruments. A survey was performed after three months of emergency distant educating linked to the COVID-19 pandemic and confirmed that half of the scholars estimated it was tough to review remotely, and reported they needed to make investments extra time in comparison with classroom educating, which led to a drop in motivation. Professors additionally famous that the time vital to speculate as a way to produce digital educating content material was monumental.
Massive open on-line laboratories (MOOLs) and course of simulators are fascinating instruments, however sensible lab work and associated know-how can not totally get replaced by digital strategies. Finally, it appeared that the professor-student interplay is essential within the distance-learning course of, and {that a} excessive stage of pedagogical (inter)exercise is obligatory to keep up motivation and higher high quality of educating and studying. How then did comparatively homogeneous RNA emerge from this primordial heterogeneity? Here we focus on nonenzymatic template-directed primer extension as a course of that may have strongly enriched for homogeneous RNA over the course of a number of cycles of replication.

Black-Box Optimization for Automated Discovery

ConspectusIn chemistry and supplies science, researchers and engineers uncover, design, and optimize chemical compounds or supplies with their skilled information and strategies. At the very best stage of abstraction, this course of is formulated as black-box optimization. For occasion, the trial-and-error course of of synthesizing numerous molecules for higher materials properties could be thought to be optimizing a black-box perform describing the relation between a chemical system and its properties.

Various black-box optimization algorithms have been developed within the machine studying and statistics communities. Recently, plenty of researchers have reported profitable functions of such algorithms to chemistry. They embrace the design of photofunctional molecules and medical medicine, optimization of thermal emission supplies and excessive Li-ion conductive strong electrolytes, and discovery of a brand new part in inorganic skinny movies for photo voltaic cells.

There are all kinds of algorithms accessible for black-box optimization, comparable to Bayesian optimization, reinforcement studying, and lively studying. Practitioners want to pick an acceptable algorithm or, in some circumstances, develop novel algorithms to fulfill their calls for. It can also be vital to find out tips on how to finest mix machine studying strategies with quantum mechanics- and molecular mechanics-based simulations, and experiments. In this Account, we give an summary of latest research relating to automated discovery, design, and optimization based mostly on black-box optimization.

The Account covers the next algorithms: Bayesian optimization to optimize the chemical or bodily properties, an optimization methodology utilizing a quantum annealer, best-arm identification, gray-box optimization, and reinforcement studying. In addition, we introduce lively studying and boundless objective-free exploration, which can not fall into the class of black-box optimization.Data high quality and amount are key for the success of those automated discovery strategies. As laboratory automation and robotics are put ahead, automated discovery algorithms would be capable of match human efficiency at the least in some domains within the close to future.

A Flash-Induced Robust Cu Electrode on Glass Substrates and Its Application for Thin-Film μLEDs

The Emergence of RNA from the Heterogeneous Products of Prebiotic Nucleotide Synthesis

Recent advances in prebiotic chemistry are starting to stipulate believable pathways for the synthesis of the canonical ribonucleotides and their meeting into oligoribonucleotides. However, these response pathways counsel that many noncanonical nucleotides are more likely to have been generated alongside the usual ribonucleotides. Thus, the oligomerization of prebiotically synthesized nucleotides is more likely to have led to a extremely heterogeneous assortment of oligonucleotides comprised of a variety of forms of nucleotides linked by a wide range of spine linkages. 

Canine CCL4 Recombinant Protein
R00703-1 5ug/vial
EUR 259
Description: The small chemotactic cytokine CCL4 (MIP-1 beta) is a chemoattractant for natural killer cells, monocytes and a variety of other immune cells. CCL4 is involved in several inflammatory and autoimmune diseases including viral infection such as HIV-1/AIDS. Canine CCL4 Recombinant Protein is purified chemokine ligand 4 (CCL4, MIP-1 beta) produced in yeast.

Chicken CCL4 Recombinant Protein
R00703-2 5ug/vial
EUR 259
Description: The small chemotactic cytokine CCL4 (MIP-1 beta) is a chemoattractant for natural killer cells, monocytes and a variety of other immune cells. CCL4 is involved in several inflammatory and autoimmune diseases including viral infection such as HIV-1/AIDS. Chicken CCL4 Recombinant Protein is purified chemokine ligand 4 (CCL4, MIP-1 beta) produced in yeast.

Mouse CCL4 Recombinant Protein
R00703-4 5ug/vial
EUR 259
Description: The small chemotactic cytokine CCL4 (MIP-1 beta) is a chemoattractant for natural killer cells, monocytes and a variety of other immune cells. CCL4 is involved in several inflammatory and autoimmune diseases including viral infection such as HIV-1/AIDS. Mouse CCL4 Recombinant Protein is purified chemokine ligand 4 (CCL4, MIP-1 beta) produced in yeast.

Rabbit CCL4 Recombinant Protein
R00703-5 5ug/vial
EUR 259
Description: The small chemotactic cytokine CCL4 (MIP-1 beta) is a chemoattractant for natural killer cells, monocytes and a variety of other immune cells. CCL4 is involved in several inflammatory and autoimmune diseases including viral infection such as HIV-1/AIDS. Rabbit CCL4 Recombinant Protein is purified chemokine ligand 4 (CCL4, MIP-1 beta) produced in yeast.

Rat CCL4 Recombinant Protein
R00703-6 5ug/vial
EUR 259
Description: The small chemotactic cytokine CCL4 (MIP-1 beta) is a chemoattractant for natural killer cells, monocytes and a variety of other immune cells. CCL4 is involved in several inflammatory and autoimmune diseases including viral infection such as HIV-1/AIDS. Rat CCL4 Recombinant Protein is purified chemokine ligand 4 (CCL4, MIP-1 beta) produced in yeast.

Swine CCL4 Recombinant Protein
R00703-7 5ug/vial
EUR 259
Description: The small chemotactic cytokine CCL4 (MIP-1 beta) is a chemoattractant for natural killer cells, monocytes and a variety of other immune cells. CCL4 is involved in several inflammatory and autoimmune diseases including viral infection such as HIV-1/AIDS. Swine CCL4 Recombinant Protein is purified chemokine ligand 4 (CCL4, MIP-1 beta) produced in yeast.

Recombinant Rat MIP-1? (CCL4)
4249-20
EUR 277

CCL4 siRNA
20-abx900872
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL4 siRNA
20-abx910792
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL4 siRNA
20-abx910793
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL4 Antibody
ABD6545 100 ug
EUR 438

CCL4 Antibody
35672-100ul 100ul
EUR 252

CCL4 antibody
38278-100ul 100ul
EUR 252

CCL4 Antibody
DF6545 200ul
EUR 304
Description: CCL4 Antibody detects endogenous levels of total CCL4.

CCL4 Antibody
CSB-PA004797KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CCL4 Antibody
CSB-PA004797KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CCL4 Antibody
1-CSB-PA005136
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CCL4 Antibody
1-CSB-PA193639
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

Ccl4 Antibody
1-CSB-PA09069A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl4. Recognizes Ccl4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCL4 Antibody
1-CSB-PA05949A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Recombinant Human MIP-1 Beta (CCL4) Protein
PROTQ8NHW4-2 10ug
EUR 317
Description: Both MIP-1α and MIP-1β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1α and MIP-1β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1α selectively attracting CD8+ lymphocytes and MIP-1β selectively attracting CD4+ lymphocytes. Additionally, MIP-1α and MIP-1β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1α and MIP-1β are active on human and murine hematopoietic cells. Recombinant human MIP-1βis a 7.6 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Human CCL4 ELISA Kit
ELA-E0093h 96 Tests
EUR 824

CCL4 ELISA KIT|Human
EF000054 96 Tests
EUR 689

Human CCL4 shRNA Plasmid
20-abx954285
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human Macrophage Inflammatory protein-1 beta (CCL4)
7-02020 2µg Ask for price

Recombinant Human Macrophage Inflammatory protein-1 beta (CCL4)
7-02021 10µg Ask for price

Recombinant Human Macrophage Inflammatory protein-1 beta (CCL4)
7-02022 1mg Ask for price

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-100ug
QP10227-ec-100ug 100ug
EUR 988

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-20ug
QP10227-ec-20ug 20ug
EUR 290

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-250ug
QP10227-ec-250ug 250ug
EUR 1731

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-5ug
QP10227-ec-5ug 5ug
EUR 154

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-10ug
QP10228-ec-10ug 10ug
EUR 290

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-2ug
QP10228-ec-2ug 2ug
EUR 154

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-1mg
QP5256-1mg 1mg
EUR 2856

Recombinant Human CCL4/ MIP1B Protein, Untagged, E.coli-500ug
QP5256-500ug 500ug
EUR 1778

Polyclonal CCL4 Antibody
APR06803G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCL4 . This antibody is tested and proven to work in the following applications:

CCL4 Conjugated Antibody
C35672 100ul
EUR 397

CCL4 cloning plasmid
CSB-CL004797HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 279
  • Sequence: ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCATGCTAGTAGCTGCCTTCTGCTCTCCAGCGCTCTCAGCACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCGAGGAAGCTTCCTCGCAACTTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTC
  • Show more
Description: A cloning plasmid for the CCL4 gene.

CCL4 Polyclonal Antibody
A53170 100 µg
EUR 570.55
Description: fast delivery possible

CCL4 Rabbit pAb
A1671-100ul 100 ul
EUR 308

CCL4 Rabbit pAb
A1671-200ul 200 ul
EUR 459

CCL4 Rabbit pAb
A1671-20ul 20 ul
EUR 183

CCL4 Rabbit pAb
A1671-50ul 50 ul
EUR 223

CCL4 Antibody (Center)
6731-100
EUR 316

CCL4 Blocking Peptide
DF6545-BP 1mg
EUR 195

Anti-CCL4 antibody
STJ22936 100 µl
EUR 277
Description: The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions.

MIP-1-beta/CCL4, Human
HY-P7257 10ug
EUR 268

CCL4 ORF Vector (Human) (pORF)
ORF016994 1.0 ug DNA
EUR 405

CCL4 ELISA Kit (Human) (OKAN04497)
OKAN04497 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.5 ng/mL

CCL4 ELISA Kit (Human) (OKAN04498)
OKAN04498 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

CCL4 ELISA Kit (Human) (OKCD05914)
OKCD05914 96 Wells
EUR 570
Description: Description of target: The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL

MIP-1 beta, CCL4, human
RC314-15 2ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Murine MIP-1 Beta (CCL4) Protein
PROTP14097-1 10ug
EUR 317
Description: Both MIP-1α and MIP-1β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1α and MIP-1β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1α selectively attracting CD8+ lymphocytes and MIP-1β selectively attracting CD4+ lymphocytes. Additionally, MIP-1α and MIP-1β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1α and MIP-1β are active on human and murine hematopoietic cells. Recombinant murine MIP-1β is a 7.8 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant Rat MIP-1 Beta (CCL4) Protein
PROTP50230-1 20ug
EUR 317
Description: Both MIP-1α and MIP-1β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1α and MIP-1β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1α selectively attracting CD8+ lymphocytes and MIP-1β selectively attracting CD4+ lymphocytes. Additionally, MIP-1α and MIP-1β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1α and MIP-1β are active on human and murine hematopoietic cells. Recombinant rat MIP-1β is a 7.8 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant (E.Coli) Human Macrophage Inflammatory protein-1 beta (CCL4)
RP-1009 10 ug
EUR 286

Polyclonal CCL4 Antibody (Center)
APR00355G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCL4 (Center). This antibody is tested and proven to work in the following applications:

Rat CCL4 shRNA Plasmid
20-abx987303
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MIP1 beta (CCL4) Antibody
abx018006-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Mouse CCL4 shRNA Plasmid
20-abx972604
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ccl4 Antibody, HRP conjugated
1-CSB-PA09069B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl4. Recognizes Ccl4 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ccl4 Antibody, FITC conjugated
1-CSB-PA09069C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl4. Recognizes Ccl4 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ccl4 Antibody, Biotin conjugated
1-CSB-PA09069D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl4. Recognizes Ccl4 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCL4 Antibody, HRP conjugated
1-CSB-PA05949B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCL4 Antibody, FITC conjugated
1-CSB-PA05949C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCL4 Antibody, Biotin conjugated
1-CSB-PA05949D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL4. Recognizes CCL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MIP-1β/CCL4 (CHO-expressed), Human
HY-P7389 50ug
EUR 497

CCL4 sgRNA CRISPR Lentivector set (Human)
K0388901 3 x 1.0 ug
EUR 339

Recombinant Mouse Macrophage Inflammatory protein-1 beta (CCL4)
7-02023 2µg Ask for price

Recombinant Mouse Macrophage Inflammatory protein-1 beta (CCL4)
7-02024 10µg Ask for price

Recombinant Mouse Macrophage Inflammatory protein-1 beta (CCL4)
7-02025 1mg Ask for price

Recombinant Mouse CCL4/ MIP1B Protein, Untagged, E.coli-100ug
QP10264-ec-100ug 100ug
EUR 988

Recombinant Mouse CCL4/ MIP1B Protein, Untagged, E.coli-10ug
QP10264-ec-10ug 10ug
EUR 290

Recombinant Mouse CCL4/ MIP1B Protein, Untagged, E.coli-250ug
QP10264-ec-250ug 250ug
EUR 1731

Recombinant Mouse CCL4/ MIP1B Protein, Untagged, E.coli-2ug
QP10264-ec-2ug 2ug
EUR 154

Recombinant Rat CCL4/ MIP1B Protein, Untagged, E.coli-100ug
QP10293-ec-100ug 100ug
EUR 988

Recombinant Rat CCL4/ MIP1B Protein, Untagged, E.coli-20ug
QP10293-ec-20ug 20ug
EUR 290

Recombinant Rat CCL4/ MIP1B Protein, Untagged, E.coli-250ug
QP10293-ec-250ug 250ug
EUR 1731

Recombinant Rat CCL4/ MIP1B Protein, Untagged, E.coli-5ug
QP10293-ec-5ug 5ug
EUR 154

Recombinant Mouse CCL4/ MIP1B Protein, Untagged, E.coli-1mg
QP5452-1mg 1mg
EUR 2856

Recombinant Mouse CCL4/ MIP1B Protein, Untagged, E.coli-500ug
QP5452-500ug 500ug
EUR 1778

Human CCL4 ELISA Kit, 96 tests, Quantitative
HCC-0L4-115 1 kit
EUR 482

CCL4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0388902 1.0 ug DNA
EUR 154

CCL4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0388903 1.0 ug DNA
EUR 154

CCL4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0388904 1.0 ug DNA
EUR 154

Human CCL4/MIP-1 beta ELISA Kit
LF-EK50838 1×96T
EUR 648

CCL4 Protein Vector (Human) (pPB-C-His)
PV067973 500 ng
EUR 552

CCL4 Protein Vector (Human) (pPB-N-His)
PV067974 500 ng
EUR 552

CCL4 Protein Vector (Human) (pPM-C-HA)
PV067975 500 ng
EUR 552

CCL4 Protein Vector (Human) (pPM-C-His)
PV067976 500 ng
EUR 552

Human MIP-1-beta/CCL4 ELISA Kit
RK00138 96 Tests
EUR 521

CCL4 ELISA Kit (Human) : 96 Wells (OKEH00165)
OKEH00165 96 Wells
EUR 544
Description: Description of target: Monokine with inflammatory and chemokinetic properties. Binds to CCR5. One of the major HIV-suppressive factors produced by CD8+ T-cells. Recombinant MIP-1-beta induces a dose-dependent inhibition of different strains of HIV-1, HIV-2, and simian immunodeficiency virus (SIV). The processed form MIP-1-beta(3-69) retains the abilities to induce down-modulation of surface expression of the chemokine receptor CCR5 and to inhibit the CCR5-mediated entry of HIV-1 in T-cells. MIP-1-beta(3-69) is also a ligand for CCR1 and CCR2 isoform B.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

MIP-1b Macrophage Inflammatory Protein-1 Beta Human Recombinant Protein (CCL4)
PROTP13236 Regular: 10ug
EUR 317
Description: Macrophage Inflammatory Protein-1 beta Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 69 amino acids and having a molecular mass of 7620 Dalton. ;The CCL4 is purified by proprietary chromatographic techniques.

CCL4 Polyclonal Antibody, HRP Conjugated
A53171 100 µg
EUR 570.55
Description: reagents widely cited

CCL4 Polyclonal Antibody, FITC Conjugated
A53172 100 µg
EUR 570.55
Description: Ask the seller for details

CCL4 Polyclonal Antibody, Biotin Conjugated
A53173 100 µg
EUR 570.55
Description: The best epigenetics products

Ccl4 ORF Vector (Mouse) (pORF)
ORF040703 1.0 ug DNA
EUR 506

Ccl4 ORF Vector (Rat) (pORF)
ORF064557 1.0 ug DNA
EUR 506

CCL4 ELISA Kit (Rabbit) (OKCD00144)
OKCD00144 96 Wells
EUR 818
Description: Description of target: Monokine with inflammatory and chemokinetic properties.By similarity ;Species reactivity: Rabbit;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 5.5 pg/mL

CCL4 ELISA Kit (Mouse) (OKAN04585)
OKAN04585 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.3 pg/mL

CCL4 ELISA Kit (Rat) (OKAN05033)
OKAN05033 96 Wells
EUR 792
Description: Description of target: a cytokine that is up-regulated during the inflammatory response; may be involved in intrapulmonary recruitment of neutrophils [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL

CCL4 ELISA Kit (Chicken) (OKCD05913)
OKCD05913 96 Wells
EUR 818
Description: Description of target: The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions.;Species reactivity: Chicken;Application: ELISA;Assay info: ;Sensitivity: < 13.6pg/mL

CCL4 ELISA Kit (Mouse) (OKCD05915)
OKCD05915 96 Wells
EUR 570
Description: Description of target: Recombinant Mouse Macrophage Inflammatory protein-1 beta (CCL4);Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.1pg/mL

CCL4 ELISA Kit (Rat) (OKCD05916)
OKCD05916 96 Wells
EUR 818
Description: Description of target: a cytokine that is up-regulated during the inflammatory response; may be involved in intrapulmonary recruitment of neutrophils.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL

CCL4 ELISA Kit (Bovine) (OKEH07283)
OKEH07283 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8pg/mL

CCL4 ELISA Kit (Chicken) (OKEH07284)
OKEH07284 96 Wells
EUR 1327
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5pg/mL

CCL4 ELISA Kit (Dog) (OKEH07285)
OKEH07285 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8pg/mL

CCL4 ELISA Kit (Pig) (OKEH07286)
OKEH07286 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8pg/mL

MIP-1 beta, CCL4, rat
RC355-15 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

ELISA kit for Human CCL4/MIP-1 Beta
EK5189 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CCL4/MIP-1 Beta in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CCL4/MIP-1 beta PicoKine ELISA Kit
EK0450 96 wells
EUR 425
Description: For quantitative detection of human CCL4 in cell culture supernates, serum and plasma(heparin, EDTA, citrate).

CCL4/MIP-1 beta ELISA Kit (Human) (OKBB00368)
OKBB00368 96 Wells
EUR 505
Description: Description of target: Chemokine (C-C motif) ligand 4, also known as CCL4, is a protein which in humans is encoded by the CCL4 gene. It is a CC chemokine with specificity for CCR5 receptors. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cells. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells. Performing-low memory CD8+ T cells that normally synthesize MIP-1-beta. the CCL4 gene was assigned to a slightly more distal location: 17q21-q23 rather than 17q11-q21.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 1 pg/mL

Pig MIP-1 Beta (CCL4) Protein
abx670310-5ug 5 ug
EUR 411
  • Shipped within 1 week.

Ccl4 sgRNA CRISPR Lentivector set (Mouse)
K3653601 3 x 1.0 ug
EUR 339

Ccl4 sgRNA CRISPR Lentivector set (Rat)
K7058901 3 x 1.0 ug
EUR 339

MIP-1 beta, CCL4, murine (mouse)
RC335-15 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

MIP-1b Macrophage Inflammatory Protein-1 beta Mouse Recombinant Protein (CCL4)
PROTP14097 Regular: 10ug
EUR 317
Description: Macrophage Inflammatory Protein-1 beta Mouse Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 69 amino acids and having a molecular mass of 7808 Dalton. ;The MIP-1b is purified by proprietary chromatographic techniques.

MIP-1b Macrophage Inflammatory Protein-1 beta Rat Recombinant Protein (CCL4)
PROTP50230 Regular: 20ug
EUR 317
Description: MIP-1b Rat Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 69 amino acids and having a molecular mass of 7.8 kDa. ;The MIP-1b is purified by proprietary chromatographic techniques.

Human CCL4/ C-C motif chemokine 4 ELISA Kit
E0389Hu 1 Kit
EUR 537

Human CCL4(C-C motif chemokine 4) ELISA Kit
EH0067 96T
EUR 524.1
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P13236
  • Alias: CCL4/MIP-1β/ACT2/AT744.1/G-26/HC21/LAG-1/LAG1/MIP-1-beta/MIP1B1/SCYA2/SCYA4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human C-C motif chemokine 4(CCL4) ELISA kit
CSB-EL004797HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human C-C motif chemokine 4 (CCL4) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human C-C motif chemokine 4(CCL4) ELISA kit
1-CSB-EL004797HU
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human C-C motif chemokine 4(CCL4) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Macrophage Inflammatory Protein 1beta (MIP-1beta)/CCL4
GT15071 100 ug
EUR 526

Macrophage Inflammatory protein-1 beta (CCL4) Protein
20-abx261530
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Macrophage Inflammatory protein-1 beta (CCL4) Protein
20-abx261562
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Macrophage Inflammatory protein-1 beta (CCL4) Protein
20-abx261577
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Mouse C-C motif chemokine 4 (Ccl4)
1-CSB-RP090694m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse C-C motif chemokine 4(Ccl4) expressed in E.coli

Ccl4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3653602 1.0 ug DNA
EUR 154

Ccl4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3653603 1.0 ug DNA
EUR 154

Ccl4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3653604 1.0 ug DNA
EUR 154

Ccl4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7058902 1.0 ug DNA
EUR 154

Ccl4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7058903 1.0 ug DNA
EUR 154

Ccl4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7058904 1.0 ug DNA
EUR 154

Rat CCL4/MIP-1 beta ELISA Kit
LF-EK50964 1×96T
EUR 648

Mouse MIP-1-beta/CCL4 ELISA Kit
RK00072 96 Tests
EUR 521

CCL4 Protein Vector (Rat) (pPB-C-His)
PV258226 500 ng
EUR 603

CCL4 Protein Vector (Rat) (pPB-N-His)
PV258227 500 ng
EUR 603

CCL4 Protein Vector (Rat) (pPM-C-HA)
PV258228 500 ng
EUR 603

CCL4 Protein Vector (Rat) (pPM-C-His)
PV258229 500 ng
EUR 603

CCL4 Protein Vector (Mouse) (pPB-C-His)
PV162810 500 ng
EUR 603

CCL4 Protein Vector (Mouse) (pPB-N-His)
PV162811 500 ng
EUR 603

CCL4 Protein Vector (Mouse) (pPM-C-HA)
PV162812 500 ng
EUR 603

CCL4 Protein Vector (Mouse) (pPM-C-His)
PV162813 500 ng
EUR 603

Ccl4 3'UTR Luciferase Stable Cell Line
TU201872 1.0 ml Ask for price

Ccl4 3'UTR GFP Stable Cell Line
TU153385 1.0 ml Ask for price

CCL4 3'UTR Luciferase Stable Cell Line
TU003751 1.0 ml
EUR 1394

Ccl4 3'UTR Luciferase Stable Cell Line
TU103385 1.0 ml Ask for price

CCL4 3'UTR GFP Stable Cell Line
TU053751 1.0 ml
EUR 1394

Ccl4 3'UTR GFP Stable Cell Line
TU251872 1.0 ml Ask for price

CCL4 ELISA Kit (Mouse) : 96 Wells (OKEH00166)
OKEH00166 96 Wells
EUR 635
Description: Description of target: Monokine with inflammatory and chemokinetic properties.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.89 pg/mL

CCL4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0388905 3 x 1.0 ug
EUR 376

Human C-C Motif Chemokine 4 / MIP1B (CCL4) ELISA Kit
20-abx152338
  • EUR 5374.00
  • EUR 2868.00
  • EUR 676.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human C-C Motif Chemokine 4 / MIP1B (CCL4) ELISA Kit
20-abx054365
  • EUR 5374.00
  • EUR 2868.00
  • EUR 676.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human C-C Motif Chemokine 4 / MIP1B (CCL4) ELISA Kit
abx351151-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human C-C Motif Chemokine 4 / MIP1B (CCL4) ELISA Kit
abx250205-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Rat CCL4/MIP-1 Beta
EK5423 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat CCL4/MIP-1 Beta in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat CCL4/MIP-1 beta PicoKine ELISA Kit
EK0939 96 wells
EUR 425
Description: For quantitative detection of rat CCL4 in cell culture supernates, serum and plasma(heparin, EDTA, citrate).

C-C Motif Chemokine 4 / MIP1B (CCL4) Antibody
20-abx109627
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-C Motif Chemokine 4 / MIP1B (CCL4) Antibody
20-abx323748
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-C Motif Chemokine 4 / MIP1B (CCL4) Antibody
abx411810-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

C-C Motif Chemokine 4 / MIP1B (CCL4) Antibody
abx412325-01mg 0.1 mg
EUR 676
  • Shipped within 1 week.

C-C Motif Chemokine 4 / MIP1B (CCL4) Antibody
abx412326-50ug 50 ug
EUR 676
  • Shipped within 1 week.

C-C Motif Chemokine 4 / MIP1B (CCL4) Antibody
20-abx242505
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCL4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV668287 1.0 ug DNA
EUR 514

CCL4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV668291 1.0 ug DNA
EUR 514

CCL4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV668292 1.0 ug DNA
EUR 514

We evaluation the results on copying the kinetics of nucleotides with altered nucleobase and sugar moieties, when they’re current as activated monomers and when they’re included into primer and template oligonucleotides. We additionally talk about three variations in spine connectivity, all of that are nonheritable and regenerate native RNA upon being copied. The kinetic superiority of RNA synthesis means that nonenzymatic copying served as a chemical choice mechanism that allowed comparatively homogeneous RNA to emerge from a posh combination of prebiotically synthesized nucleotides and oligonucleotides.

The Future of Ligand Engineering in Colloidal Semiconductor Nanocrystals